Transcript asmbl_11167

Sequence
Transcript Sequence for observation asmbl_11167 of TGE0031172:
AGGGCGGGGACAATTGAGAACGCTTCCCGCCGGCGCGCTTTCGGTTTTCAATCTGGTCCGATACTCTTGTATATCAGGGGAAGACGGTGCTCGCCTTGACAGAAGCTGTCTATCGGGCTCCAGCGGTCATGTCCGGCAGAGGAAAGGGCGGAAAAGGCTTAGGCAAAGGGGGCGCTAAGCGCCACCGCAAGGTCTTGAGAGACAACATTCAGGGCATCACCAAGCCTGCCATTCGGCGTCTAGCTCGGCGTGGCGGCGTTAAGCGGATCTCTGGCCTCATTTACGAGGAGACCCGCGGTGTGCTGAAGGTGTTCCTGGAGAATGTGATTCGGGACGCAGTCACCTACACCGAGCACGCCAAGCGCAAGACCGTCACAGCCATGGATGTGGTGTACGCGCTCAAGCGCCAGGGGCGCACCCTGTACGGCTTCGGAGGCTAGGCCGCCGCTCCAGCTTTGCACGTTTCGATCCCAAAGGCCCTTTTTAGGGCCGACCACTTGCTCATCTGAGGAGTTGGACACTTGACTGCGTAAAGTGCAACAGTAACGATGTTGGAAGGCTTATGATTTTACTGTGTATGTATTTGGGAGAAGAAATTCTGTCAGCTCCCAAAGGATAAACCAGCAGTTGCTTTATTGGTCTTCAGATGTGGCTGCAAACACTTGAGACTGAACTAAGCTTAAAACACGGTACTTAGCAATCGGGTTGCCAGCAAAGCACTGGATGCAAGCCTTGCCTTCCAGAAGCTTACCAGTCGGGTTGCCAGCAAAGCAGTGGATGCAAGACTTGCCCTCCAGGAGCTTACCATCACAACGAAGAAGACAAATAAATGCATAATATATAGACGACATAAATCCATACTGTACACATTTAAGAATAAACAGTCCAGTAGTAAGAGGCAGTACATATTCAATCTGCTGAG