Transcript asmbl_109784

Sequence
Transcript Sequence for observation asmbl_109784 of TGE0057574:
CCTAATTCTACCCCCCTTGGTGCCAACAGATGAGGTTCACAATCTCTTCCACAAAACATGCAGTTAAATATCTGAGGATATTCAGGGACTTGGATTTGGTGGCAGGAGATCAACATAAACCAAGACAAGGAAGAAGTCAAAGAAATGAATCAAGTAGATTCTCTGGGATATAAGGTAGGGGGATTGGGGGGTTGGATAGTGCAGAGTATGGTACTGGCCTAAGGCACTGAGGATCATCCTTTTCCCACACCCACCAGAGAAGGCTTAGGCTCCCGAGTCAACAGGGCATTCACCGCCTGGGGCGCCTGAGTCATCAGGACACTGCCAGGAGACACAGAACCCTAGATGCCCTGCAGAATCCTTCCTGTTACGGTCCCCCTCCCTGAAACATCCTTCATTGCAATATTTCCAGGAAAGGAAGGGGGCTGGCTCGGAGGAAGAGAGGTGGGGAGGTGATCAGGGTTCACAGAGGAGGGAACTGAATGACATCCCAGGATTACATAAACTGTCAGAGGCAGCCGAAGAGTTCACAAGTGTGAAGCCTGGAAGCCGGCGGGTGCCGCTGTGTAGGAAAGAAGCTAAAGCACTTCCAGAGCCTGTCCGGAGCTCAGAGGTTCGGAAGACTTATCGACCATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTAAAGATAACCGGCACCATGCCTCCGCTGCCTCTGGAAGCCACAGGACTTGCACTTTCCAGCTTGCGCCTACGCAACGTGTCGTGGGCGACAGGGCGTTCTTGGCTCGCCGAGCTGCAGCAGTGGCTCAAGCCAGGCCTCAAGGTACTGAGCATTGCCCAAGCACACTCGCCTGCCTTTTCCTGCGAACAGGTTCGCGCCTTCCCGGCCCTTACCAGCCTAGACCTGTCTGACAATCCTGGACTGGGCGAACGCGGACTGATGGCGGCTCTCTGTCCCCACAAGTTCCCGGCCATCCAGAATCTAGCGCTGCGCAACACAGGAATGGAGACGCCCACAGGCGTGTGCGCCGCACTGGCGGCGGCAGGTGTGCAGCCCCACAGCCTAGACCTCAGCCACAACTCGCTGCGCGCCACCGTAAACCCTAGCGCTCCGAGATGCATGTGGTCCAGCGCCCTGAACTCCCTCAATCTGTCGTTCGCTGGGCTGGAACAGGTGCCTAAAGGACTGCCAGCCAAGCTCAGAGTGCTCGATCTCAGCTGCAACAGACTGAACAGGGCGCCGCAGCCTGACGAGCTGCCCGAGGTGGATAACCTGACACTGGACGGGAATCCCTTCCTGGTCCCTGGAACTGCCCTCCCCCACGAGGGCTCAATGAACTCCGGCGTGGTCCCAGCCTGTGCACGTTCGACCCTGTCGGTGGGGGTGTCGGGAACCCTGGTGCTGCTCCAAGGGGCCCGGGGCTTTGCCTAAGATCCAAGACAGAATAATGAATGGACTCAAACTGCCTTGGCTTCAGGGGAGTCCCGTCAGGACGTTGAGGACTTTTCGACCAATTCAACCCTTTGCCCCACCTTTATTAAAATCTTAAACAACGGGTCCGTGTCATTCATTTAACAGACCTTTATTGGATGTCTGCTATGTGCTGGGCACAGTGCTGGATGGGGAATTCATCATACTTAGGCTTTCTTCATCCTAACTCCCTAAGAAACCCTATCTGTCCTCCTCAAGAAAAGAACTGCGGGGATAGAAGGAGCCAGGAAAGGACTCCTGGCTAGGGCTGCATGGGAGAAACAATGAGTGTGCAGTCAGGGCTTTCTGAGCAGATTATTGGCATCTGGATTAAAAGGTATTTGCATGATATTTGGAAGATACAAAATATTTCCTCTCCTATGCACTTCCCAAGAGCCAGCTGCTCCCTTTCAAAGGTAATAAAACCCACAGCCATTTGCTTATTTCCTTATTCTTTCTCTCTCTCACACACACACACACTCACACACCCTCCCTCTCCCTCTCTGTCTGTCTCCCTTACCACTCAAGGAAGAGGGACAGCCTCCTATCCTGCACAAGCTCTGAGTTTCATAATATTAGGGTTCCTCTCTTGTAAAACCTCTCTTCACCCGGAGGCTTTCACTGTGTCACTCCCCGACATAATGGGAAATTTGGGCC