Transcript asmbl_109783

Sequence
Transcript Sequence for observation asmbl_109783 of TGE0057574:
CCTAATTCTACCCCCCTTGGTGCCAACAGATGAGGTTCACAATCTCTTCCACAAAACATGCAGTTAAATATCTGAGGATATTCAGGGACTTGGATTTGGTGGCAGGAGATCAACATAAACCAAGACAAGGAAGAAGTCAAAGAAATGAATCAAGTAGATTCTCTGGGATATAAGAGGCAGCCGAAGAGTTCACAAGTGTGAAGCCTGGAAGCCGGCGGGTGCCGCTGTGTAGGAAAGAAGCTAAAGCACTTCCAGAGCCTGTCCGGAGCTCAGAGGTTCGGAAGACTTATCGACCATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTAAAGATAACCGGCACCATGCCTCCGCTGCCTCTGGAAGCCACAGGACTTGCACTTTCCAGCTTGCGCCTACGCAACGTGTCGTGGGCGACAGGGCGTTCTTGGCTCGCCGAGCTGCAGCAGTGGCTCAAGCCAGGCCTCAAGGTACTGAGCATTGCCCAAGCACACTCGCCTGCCTTTTCCTGCGAACAGGTTCGCGCCTTCCCGGCCCTTACCAGCCTAGACCTGTCTGACAATCCTGGACTGGGCGAACGCGGACTGATGGCGGCTCTCTGTCCCCACAAGTTCCCGGCCATCCAGAATCTAGCGCTGCGCAACACAGGAATGGAGACGCCCACAGGCGTGTGCGCCGCACTGGCGGCGGCAGGTGTGCAGCCCCACAGCCTAGACCTCAGCCACAACTCGCTGCGCGCCACCGTAAACCCTAGCGCTCCGAGATGCATGTGGTCCAGCGCCCTGAACTCCCTCAATCTGTCGTTCGCTGGGCTGGAACAGGTGCCTAAAGGACTGCCAGCCAAGCTCAGAGTGCTCGATCTCAGCTGCAACAGACTGAACAGGGCGCCGCAGCCTGACGAGCTGCCCGAGGTGGATAACCTGACACTGGACGGGAATCCCTTCCTGGTCCCTGGAACTGCCCTCCCCCACGAGGGCTCAATGAACTCCGGCGTGGTCCCAGCCTGTGCACGTTCGACCCTGTCGGTGGGGGTGTCGGGAACCCTGGTGCTGCTCCAAGGGGCCCGGGGCTTTGCCTAAGATCCAAGACAGAATAATGAATGGACTCAAACTGCCTTGGCTTCAGGGGAGTCCCGTCAGGACGTTGAGGACTTTTCGACCAATTCAACCCTTTGCCCCACCTTTATTAAAATCTTAAACAACGGGTCCGTGTCATTCATTTAACAGACCTTTATTGGATGTCTGCTATGTGCTGGGCACAGTGCTGGATGGGGAATTCATCATACTTAGGCTTTCTTCATCCTAACTCCCTAAGAAACCCTATCTGTCCTCCTCAAGAAAAGAACTGCGGGGATAGAAGGAGCCAGGAAAGGACTCCTGGCTAGGGCTGCATGGGAGAAACAATGAGTGTGCAGTCAGGGCTTTCTGAGCAGATTATTGGCATCTGGATTAAAAGGTATTTGCATGATATTTGGAAGATACAAAATATTTCCTCTCCTATGCACTTCCCAAGAGCCAGCTGCTCCCTTTCAAAGGTAATAAAACCCACAGCCATTTGCTTATTTCCTTATTCTTTCTCTCTCTCACACACACACACACTCACACACCCTCCCTCTCCCTCTCTGTCTGTCTCCCTTACCACTCAAGGAAGAGGGACAGCCTCCTATCCTGCACAAGCTCTGAGTTTCATAATATTAGGGTTCCTCTCTTGTAAAACCTCTCTTCACCCGGAGGCTTTCACTGTGTCACTCCCCGACATAATGGGAAATTTGGGCC