Transcript asmbl_10103

Sequence
Transcript Sequence for observation asmbl_10103 of TGE0059784:
GGACCCATCCCACCTGTCAGGATCGAGTCTTCATCCTCCACAGTGGCCGAGGGCCAGACCCTGGATCTGAGCTGCGTGGTGGCAGGGCAGGCCCACGCCCAGGTCACATGGTACAAGCGTGGGGGCAGCCTCCCTGCCCGGCACCAGGTTCGTGGCTCCCGCCTGTACATCTTCCAGGCCTCACCTGCCGATGCGGGACAGTACGTCTGCCGGGCCAGCAACGGCATGGAGGCCTCCATCACGGTCACAGTAACTGGGACCCAGGGGGCCAACTTAGCCTACCCTGCCGGCAGCACCCAGCCCATCCGCATCGAGCCCTCCTCCTCGCAAGTGGCGGAAGGGCAGACCCTGGATCTGAACTGCGTGGTGCCCGGGCAGTCCCATGCCCAGGTCACGTGGCACAAGCGCGGGGGCAGCCTCCCGGCCCGGCACCAGGTGCATGGCTCGAGGCTACGCCTGCTCCAGGTGACCCCAGCTGATTCAGGGGAGTACGTGTGCCGTGTGGTCGGCAGCTCAGGTACCCAGGAAGCCTCAGTCCTTGTCACCATCCAGCAGCGCCTTAGTGGCTCCCACTCCCAGGGTGTGGCGTACCCCGTCCGCATCGAGTCCTCCTCAGCCTCCCTGGCCAATGGACACACCCTGGACCTCAACTGCCTGGTTGCCAGCCAGGCTCCCCACACCATCACCTGGTATAAGCGTGGAGGCAGCTTACCCAGCCGGCACCAGATCGTGGGCTCCCGGCTGCGGATCCCTCAGGTGACTCCGGCAGACTCGGGCGAGTACGTGTGTCACGTCAGTAACGGTGCAGGCTCCCGGGAGACCTCGCTCATCGTCACCATCCAGGGCAGCGGTTCCTCCCACGTGCCCAGCGTCTCCCCACCGATCAGGATCGAGTCGTCTTCCCCCACGGTGGTGGAAGGGCAGACCTTGGATCTGAACTGCGTGGTCGCCAGGCAGCCCCAGGCTATCATCACATGG