Transcript asmbl_9402

Sequence
Transcript Sequence for observation asmbl_9402 of TGE0056954:
CTATTTCCCGGGGTGGGAACGCCGGGAGGCGGGAGGAGAGGGGGCTGCCAGGGGCGTCCGGTTACATCCCCGCCTTCCTCTGTCCTGGCCGCGGGACCGGGTTTGCGGGACCGCAGTTCGGGAACATGTTGGCCTCGAGCAGCCGGATCCGGGCTGCGTGGACGCGGGCGCTGCTGCTGCCGCTGCTGCTGGCGGGGCCTGTGGGCTGCCTGAGCCGCCAGGAGCTCTTTCCCTTCGGCCCCGGACAGGGGGACCTGGAGCTGGAGGACGGGGATGACTTCGTCTCTCCTGCCCTGGAGCTGAGTGGGGCGCTCCGCTTCTACGACAGATCCGACATCGACGCAGTCTACGTCACCACAAATGGCATCATTGCTACGAGTGAACCCCCGGCCAAAGAATCCCATCCCGGGCTCTTCCCACCAACATTCGGTGCAGTCGCCCCTTTCCTGGCGGACTTGGACACGACCGATGGCCTGGGGAAGGTTTATTATCGAGAAGACTTATCCCCCTCCATCACTCAGCGAGCAGCAGAGTGTGTCCACAGAGGGTTCCCGGAGATCTCTTTCCAGCCTAGTAGCGCGGTGGTTGTCACTTGGGAATCCGTGGCCCCCTACCAAGGGCCCAGCAGGGACCCAGACCAGAAAGGCAAGAGAAACACGTTCCAGGCTGTTCTAGCCTCCTCTGATTCCAGCTCCTATGCCATTTTCCTTTATCCTGAGGATGGTCTGCAGTTCCATACGACATTCTCAAAGAAGGAAAACAACCAAGTTCCTGCCGTGGTTGCATTCAGTCAAGGTTCAGTGGGATTCTTATGGAAGAGCAACGGAGCTTATAACATATTTGCTAATGACAGGGAATCAGTTGAAAATTTGGCCAAGAGTAGTAACTCTGGGCAGCAGGGTGTCTGGGTGTTTGAGATTGGGAGTCCAGCCACCACCAATGGCGTGGTGCCTGCAGACGTGATCCTCGGAACTGAAGATGGGGCAGAGTATGATGATGAGGATGAAGATTATGACCTGGCGACCACTCGTCTGGGCCTGGAGGATGTGGGCACCACGCCCTTCTCCTACAAGGCTCTGAGAAGGGGAGGTGCTGACACATACAGTGTGCCCAGCGTCCTCTCCCCGCGCCGGGCAGCTACCGAAAGGCCCCTTGGACCTCCCACAGAGAGAACCAGGTCTTTCCAGTTGGCAGTGGAGACTTTTCACCAGCAGCACCCTCAGGTCATAGATGTGGATGAAGTTGAGGAAACAGGAGTTGTTTTCAGCTATAACACGGATTCCCGCCAGACGTGTGCTAACAACAGACACCAGTGCTCGGTGCACGCAGAGTGCAGGGACTACGCCACGGGCTTCTGCTGCAGCTGTGTCGCTGGCTATACGGGCAATGGCAGGCAATGTGTTGCAGAAGGTTCCCCCCAGCGAGTCAATGGCAAGGTGAAAGGAAGGATCTTTGTGGGGAGCAGCCAGGTCCCCATTGTCTTTGAGAACACTGACCTCCACTCTTACGTAGTAATGAACCACGGGCGCTCCTACACAGCCATCAGCACCATTCCCGAGACCGTTGGATATTCTCTGCTTCCACTGGCCCCAGTTGGAGGCATCATTGGATGGATGTTTGCAGTGGAGCAGGACGGATTCAAGAATGGGTTCAGCATCACCGGGGGTGAGTTCACTCGCCAGGCTGAGGTGACCTTCGTGGGGCACCCGGGCAATCTGGTCATTAAGCAGCGGTTCAGCGGCATCGATGAGCATGGGCACCTGACCATCGACACGGAGCTGGAGGGCCGCGTGCCGCAGATTCCGTTCGGCTCCTCCGTGCACATTGAGCCCTACACGGAGCTGTACCACTACTCCACCTCAGTGATCACTTCCTCCTCCACCCGGGAGTACACGGTGACTGAGCCCGAGCGAGATGGGGCATCTCCTTCACGCATCTACACTTACCAGTGGCGCCAGACCATCACCTTCCAGGAATGCGTCCACGATGACTCCCGGCCAGCCCTGCCCAGCACCCAGCAGCTCTCGGTGGACAGCGTGTTCGTCCTGTACAACCAGGAGGAGAAGATCTTGCGCTATGCTCTCAGCAACTCCATTGGGCCTGTGAGGGAAGGCTCCCCTGATGCTCTTCAGAATCCCTGCTACATCGGCACTCATGGGTGTGACACCAACGCGGCCTGTCGCCCTGGTCCCAGGACACAGTTCACCTGCGAGTGCTCCATCGGCTTCCGAGGAGACGGGCGAACCTGCTATGATATTGATGAATGTTCAGAACAACCCTCAGTGTGTGGGAGCCACACAATCTGCAATAATCACCCAGGAACCTTCCGCTGCGAGTGTGTGGAGGGCTACCAGTTTTCAGATGAGGGAACGTGTGTGGCTGTCGTGGACCAGCGCCCCATCAACTACTGTGAAACTGGCCTTCATAACTGCGACATACCCCAGCGGGCCCAGTGTATCTACACAGGAGGCTCCTCCTACACCTGTTCCTGCTTGCCAGGCTTTTCTGGGGATGGCCAAGCCTGCCAAGATGTAGATGAATGCCAGCCAAGCCGATGTCACCCTGACGCCTTCTGCTACAACACTCCAGGCTCTTTCACGTGCCAGTGCAAACCTGGTTATCAGGGAGACGGCTTCCGTTGCGTGCCCGGAGAGGTGGAGAAAACCCGGTGCCAGCACGAGCGAGAACACATTCTCGGGGCAGCGGGGGCGACAGACCCACAGCGACCCATTCCTCCGGGGCTGTTCGTTCCTGAGTGCGATGCGCACGGGCACTACGCGCCCACCCAGTGCCACGGCAGCACCGGCTACTGCTGGTGCGTGGATCGCGACGGCCGCGAGGTGGAGGGCACCAGGACCAGGCCCGGGATGACGCCCCCGTGTCTGAGTACAGTGGCTCCCCCGATTCACCAAGGACCTGCGGTGCCTACCGCCGTGATCCCCTTGCCTCCTGGGACCCATTTACTCTTTGCCCAGACTGGGAAGATTGAGCGCCTGCCCCTGGAGGGAAATACCATGAGGAAGACAGAAGCAAAGGCGTTCCTTCATGTCCCGGCTAAAGTCATCATTGGACTGGCCTTTGACTGCGTGGACAAGATGGTTTACTGGACGGACATCACTGAGCCTTCCATTGGGAGAGCTAGTCTACATGGTGGAGAGCCAACCACCATCATTAGACAAGATCTTGGAAGTCCAGAAGGTATCGCTGTTGATCACCTTGGCCGCAACATCTTCTGGACAGACTCTAACCTGGATCGAATAGAAGTGGCGAAGCTGGACGGCACGCAGCGCCGGGTGCTCTTTGAGACTGACTTGGTGAATCCCAGAGGCATTGTAACGGATTCCGTGAGAGGGAACCTTTACTGGACAGACTGGAACAGAGATAACCCCAAGATTGAAACTTCCTACATGGACGGCACGAACCGGAGGATCCTTGTGCAGGATGACCTGGGCTTGCCCAATGGACTGACCTTCGATGCGTTCTCATCTCAGCTCTGCTGGGTGGATGCAGGCACCAATCGGGCGGAATGCCTGAACCCCAGTCAGCCCAGCAGACGCAAGGCTCTCGAAGGGCTCCAGTATCCTTTTGCTGTGACGAGCTACGGGAAGAATCTGTATTTCACAGACTGGAAGATGAATTCCGTGGTTGCTCTCGATCTTGCAATTTCCAAGGAGACGGATGCTTTCCAACCCCACAAGCAGACCCGGCTGTATGGCATCACCACGGCCCTGTCTCAGTGTCCGCAAGGCCATAACTACTGCTCAGTGAACAATGGCGGCTGCACCCACCTATGCTTGGCCACCCCAGGGAGCAGGACCTGCCGTTGCCCTGACAACACCTTGGGAGTTGACTGTATCGAACAGAAATGAAGACAAGAGTGCCTTATTTCCTTTCCAAGTATTTCACAGCAACACTCTACTTGAAGCAACTTGGTCCAGATTGAAAAGTGTCCTCTGGCTGAGTGGCCACTAGGCCCAGACCCAGCCCAGCCTGAGCCCCAACAACTTTTCCCTCACTGTTCCCCAAAACATGCACCCTGGACTTCTCTAATAGAAAAGTCTCCACCCCTACACAAGGACAGAACCCTCCACCCCTACCCCCAACCCTCAGACAGACTTATACACCCCTGAGTGAGGATTACATGCCCATCCCAGTGTCCTAGGACCTTTTCCCAATACTAGCCCCCCAGTGGTGAACAGAACCTCCCAAATTTGAGTTGCACCCTTCCCTGTGGCCTTATGAGCTCAGCCTCGCTTTGAGGTACCCACCGTCCTGTCAGCTCCTTGACCTATGAGCCGGGGCCTGACTAGGAAAAGTTGGGAGTTAAGGAGGAAATTAGCATTCCTTAATGTTTTGTTTTGGTGCTCTGAATTTCTTCTTTATTATAGTCCTATAGTTTTACTCCTCAGTTCCTCACCATCATCATCTTGTCTAAGACCCCCATTATAATATTCATGCGCTGCTTTTTCATCAAAACCTACCCTGTCCTAGAGATCTATGGGCATTTGGTGGATGATAATGAGCAGCCCCTCCCAGATAGAATGTCAATATTTGAGCAGTAGGATATTGGCATTTGTTAGTTAAAGGCTTAAATCAAAAGAATGTCCAATGGTAGGAATTTCAAGGTGTAGGTCAGATATTTGAGAATAGGGGATTTTTTTGATGTGCCTTAAATTATACCAAAGATTACTAATTATTCCTCTTTGCCCAAAATACTTGCATCCAAGGTTCTAGTCTCTGTTGCTGTGCTGGTCTTTAGCCCCACTGCTTGCACTGATGTCCCTCCTTTTCACGGAGACCTATCTGAGGTACAGGATGGGGCTGGCACCAGATGATGTCCCACCACAGTCCCTCACCTCCGGCCTCCACATGACAGAACCAATTTACACTCAACCATGACCTCACCCCTCCTTGGTTTCTCCCTCGATCTGTGGCCCTTTTTGGATGTATTCTTATCTAACAACACAATCCGGAAAGACTGAATTGAATATTTATACTAATGGTTCATATCCTTTATTGCTCAATGATCTAATTAAAGGGATCATTGCCACATTTCATGTTTATATTTCTACAATTTGTTTAGAAAACATCTCCTGACCATATCAGTAGCTCGTGTTATCTTTTTATCAACTGCTTCCCAGAGTCCTAAAACAATAGAAATTTTGGATTGAAAAGTTCAGCATAAGGAGTTTGAGTCAGTAAAGGATGGGATAAAGGAGTCGAGATGATTCAATGAAAAGTATCACAAAAAAGAGATTGATCAACAAGAGAAATAAAAAAGCCCAAGAGGAAGTGGTAGGGGAAGGAATTTAAGAACAGCAATAAGTAAAACTCTTAAGTAACTCCAAAAAGAAAATGGTACATTTTGCCAAAGACCACTTATACTTGAGAACATGGAAGAATTTGCCTGATACTCTCTTTGGGGAAAAGAGTCTCTCCTCTTTTCCTCAAACCCCAGTACACTCAGCCTCTCTGCCCCACCTTCTCCTGACTTTGTCCTCACTTGCTTCTGCAGTACATTGGAACCTGAATTGAAAGAAAGTCTTCCTTGAATAATTGGAGTTTGTCTTGAGAGGCAAATATAGCCCCAAGAATCACAAGATTCGAGGACCATGTAGGTCTTTTACGTAGCCCAAATCCATAAATTAGTCTCACTTTTTGTATTTATCGTTTCATATTAAACCCTCTATATCAAATGTTCATCATGATTTTGTATGATTTTTATAACTATTTTATTCATTTTATTAGATTTATTCTAAAATTTTTTAATGGTAAATTCTTAAACTGTGGAAACCACTGAAGGTGCTTATTAACTGTTCTCCCAGATTTGTACAAGTATTGGATGATTCCTTGAGTTTACAGCTGTACAAATAGTGTGGAAAATAAACTTTTTTT