Transcript asmbl_7678

Sequence
Transcript Sequence for observation asmbl_7678 of TGE0057110:
CCAGACCCACGGCTCCCTGCTGAGACTCTACCAAGCGTCCCCCGCCGACTCGGGCGAGTACGTGTGCCGAGTGTTGGGCAGCTCCGTGCCTCTAGAGGCCTCTGTCCTGGTCACCATTGAGCCTGCGGGCTCAGTGCCTGCACTTGGGGTCACCCCCACGGTCCGGATCGAGTCATCGTCTTCGCAAGTGGCCGAGGGGCAGACCCTGGACCTGAACTGCCTCGTTGCTGGTCAGGCCCATGCCCAGGTCACGTGGCACAAGCGCGGGGGCAGCCTCCCGGCCCGGCACCAGACCCATGGCTCCCAGCTGCGGCTCCACCTCGTCTCCCCTGCCGACTCAGGCGAGTATGTGTGTCGTGCAGCCAGCGGCCCAGGCCCTGAGCAAGAAGCCTCCTTCACAGTCACCGTCCCGCCCAGTGAGGGGTCTTCCTACCGCCTTAGGAGCCCGGTCATCTCCATCGACCCGCCCAGCAGCACCGTGCAGCAGGGCCAGGATGCCAGCTTCAAGTGCCTCATCCATGACGGGGCAGCCCCCATCAGCCTCGAGTGGAAGACCCGGAACCAGGAGCTGGAGGACAACGTCCACATCAGTCCCAATGGCTCCATCATCACCATCGTGGGCACCCGGCCCAGCAACCACGGTACCTACCGCTGCGTGGCCTCCAATGCCTACGGTGTGGCCCAGAGTGTGGTGAACCTCAGTGTGCACGGGCCCCCTACAGTGTCCGTGCTCCCCGAGGGCCCCGTGTGGGTGAAAGTGGGAAAGGCTGTCACCCTGGAGTGTGTCAGTGCCGGGGAGCCCCGCTCCTCTGCTCGTTGGACCCGGATCAGCAGCACCCCTGCCAAGTTGGAGCAGCGGACATATGGGCTCATGGACAGCCACGCGGTGCTGCAGATTTCATCAGCTAAACCATCAGATGCGGGCACTTATGTGTGCCTTGCTCAGAATGCACTAGGCACAGCACAGAAGCAGGTGGAGGTGATCGTGGACACGGGCGCCATGGCCCCAGGGGCCCCTCAGGTCCAAGCTGAAGAAGCTGAGCTGACTGTGGAGGCTGGACACACGGCCACCTTGCGCTGCTCAGCCACAGGCAGCCCCGCGCCCACCATCCACTGGTCCAAGCTGCGTTCCCCACTGCCCTGGCAGCACCGGCTGGAAGGTGACACACTCATCATACCCCGGGTAGCCCAGCAGGACTCGGGCCAGTACATCTGCAATGCCACTAGCCCTGCTGGGCACGCTGAGGCCACCATCATCCTGCACGTGGAGAGCCCACCATATGCCACCACGGTCCCAGAGCACGCTTCGGTGCAGGCAGGGGAGACGGTGCAGCTCCAGTGCCTGGCTCACGGGACACCCCCACTCACCTTCCAGTGGAGCCGCGTGGGCAGCAGCCTTCCTGGGAGGGCGACCGCCAGGAACGAGCTGCTGCACTTTGAGCGTGCAGCCCCTGAGGACTCAGGCCGCTACCGCTGCCGGGTCACCAACAAGGTGGGCTCAGCCGAGGCCTTTGCCCAGCTGCTCGTCCAAGGCCCTCCCGGCTCTCTCCCTGCCACCTCCATCCCAGCAGGGTCCACGCCCACCGTGCAGGTCACGCCTCAGCTAGAGACCAAGAGCATTGGGGCCAGCGTTGAGTTCCACTGTGCTGTGCCCAGCGACCGGGGTACCCAGCTCCGTTGGTTCAAGGAAGGGGGTCAGCTGCCTCCGGGTCACAGCGTGCAGGATGGGGTGCTCCGAATCCAGAACTTGGACCAGAGCTGCCAAGGGACGTATATATGCCAGGCCCATGGACCTTGGGGGAAGGCCCAGGCCAGTGCCCAGCTGGTTATCCAAGCCCTGCCCTCGGTGCTCATCAACATCCGGACCTCTGTGCAGACCGTGGTGGTTGGCCACGCCGTGGAGTTCGAATGCCTGGCACTGGGTGACCCCAAGCCTCAGGTGACATGGAGCAAAGTTGGAGGGCACCTGCGGCCAGGCATTGTGCAGAGCGGAGGTGTCGTCAGGATCGCCCACGTAGAGCTGGCTGATGCGGGACAGTATCGCTGCACTGCCACCAACGCAGCTGGCACCACACAATCCCACGTCCTGCTGCTTGTGCAAGCCTTGCCCCAGATCTCAATGCCCCAAGAAGTCCGTGTGCCTGCTGGTTCTGCAGCTGTCTTCCCCTGCATAGCCTCAGGCTACCCCACTCCTGACATCAGCTGGAGCAAGCTGGATGGCAGCCTGCCACCTGACAGCCGCCTGGAGAACAACATGCTGATGCTGCCCTCAGTCCGACCCCAGGACGCAGGTACCTACGTCTGCACCGCCACTAACCGCCAGGGCAAGGTCAAAGCCTTTGCCCACCTGCAGGTGCCAGAGCGGGTGGTGCCCTACTTCACGCAGACCCCCTACTCCTTCCTACCGCTGCCCACCATCAAGGATGCCTACAGGAAGTTCGAGATCAAGATCACCTTCCGGCCCGACTCAGCCGATGGGATGCTGCTGTACAATGGGCAGAAGCGAGTCCCAGGGAGCCCCACCAACCTGGCCAACCGGCAGCCCGACTTCATCTCCTTCGGCCTCGTGGGGGGAAGGCCCGAGTTCCGGTTCGATGCAGGCTCAGGCATGGCCACCATCCGCCATCCCACACCACTGGCCCTGGGCCATTTCCACACCGTGACCCTGCTGCGCAGCCTCACCCAGGGCTCCCTGATTGTGGGTGACCTGGCCCCGGTCAATGGGACCTCCCAGGGCAAGTTCCAGGGCCTGGATCTGAACGAGGAACTCTACCTGGGTGGCTATCCTGACTATGGTGCCATCCCCAAGGCGGGGCTGAGCAGCGGCTTCATAGGCTGTGTCCGGGAGCTGCGCATCCAGGGCGAGGAGATCGTCTTCCATGACCTCAACCTCACGGCGCACGGCATCTCCCACTGCCCCACCTGTCGGGACCGGCCCTGCCAGAATGGCGGTCAGTGCCATGACTCTGAGAGCAGCAGCTACGTGTGCGTCTGCCCAGCTGGCTTCACCGGGAGCCGCTGTGAGCACTCGCAGGCCCTGCACTGCCATCCAGAGGCCTGTGGGCCCGACGCCACCTGTGTGAACCGGCCTGACGGTCGAGGCTACACCTGCCGCTGCCACCTGGGCCGCTCGGGGTTGCGGTGTGAGGAAGGTGTGACAGTGACCACCCCCTCGCTGTCGGGTGCTGGCTCCTACCTGGCACTGCCCGCCCTCACCAACACACACCACGAGCTACGCCTGGACGTGGAGTTCAAGCCACTCGCCCCTGACGGGGTCCTGCTGTTCAGCGGGGGGAAGAGCGGGCCTGTGGAGGACTTCGTGTCCCTGGCGATGGTGGGCGGCCACCTGGAGTTCCGCTATGAGTTGGGGTCAGGGCTGGCCGTTCTGCGGAGCGCCGAGCCGCTGGCCCTGGGCCGCTGGCACCGTGTGTCTGCAGAGCGTCTCAACAAGGACGGCAGCCTGCGGGTGAATGGTGGACGCCCTGTGCTGCGCTCCTCGCCCGGCAAGAGCCAGGGCCTCAACCTGCACACCCTGCTCTACCTGGGGGGTGTGGAGCCTTCCGTGCCACTGTCCCCGGCCACCAACATGAGCGCTCACTTCCGCGGCTGTGTGGGCGAGGTGTCAGTGAATGGCAAACGGCTGGACCTCACCTACAGTTTCCTAGGCAGCCAGGGCATCGGGCAATGCTATGATAGCTCCCCATGTGAGCGCCAGCCTTGCCAACATGGTGCCACGTGCATGCCCGCTGGCGAGTATGAGTTCCAGTGCCTGTGTCGAGATGGATTCAAAGGAGACCTGTGTGAGCACGAGGAGAACCCCTGCCAGCTCCGTGAACCCTGTCTGCATGGGGGCACCTGCCAGGGCACCCGCTGCCTCTGCCTCCCTGGCTTCTCTGGCCCACGCTGCCAACAAGGCTCTGGACATGGCATAGCAGAGTCCGACTGGCATCTTGAAGGCAGCGGGGGCAATGATGCCCCTGGGCAGTACGGAGCCTATTTCCACGATGATGGCTTCCTCGCCTTCCCTGGCCATGTCTTCTCCAGGAGCCTGCCCGAGGTGCCCGAGACCATCGAGCTGGAGGTTCGGACCAGCACAGCCAGTGGCCTCCTGCTCTGGCAGGGTGTGGAGGTGGGAGAGGCCGGCCAAGGCAAGGACTTCATCAGCCTCGGGCTTCAAGACGGGCACCTTGTCTTCAGGTACCAGCTGGGTAGTGGGGAGGCCCGCCTGGTCTCTGAGGACCCCATCAATGACGGCGAGTGGCACCGGGTGACAGCACTGCGGGAGGGCCGCAGAGGTTCCATCCAAGTCGACGGTGAGGAGCTGGTCAGCGGCCGGTCCCCAGGTCCCAACGTGGCAGTCAACGCCAAGGGCAGCGTCTACATCGGCGGAGCCCCTGACGTGGCCACGCTGACCGGGGGCAGATTCTCCTCAGGCATCACAGGCTGTGTCAAGAACCTGGTGCTGCACTCGGCCCGACCCGGCGCCCCGCCCCCACAGCCCCTGGACCTGCAGCACCGCGCCCAGGCCGGGGCCAACACACGCCCCTGCCCCTCGTAGGCACCTGCCTGCCCCACACGGACTCCCGGGCCACGCCCCAGCCCGACAATGTCGAGTATATTATTATTAATATTATTATGAATTTTTGTAAGAAACCGAGGCGATGCCACGCTTTGCTGCTACCGCCCTGGGCTGGACTGGAGGTGGGCATGCCACCCTCACACACACAGCTGGGCAAAGCCACAAGGCTGGCCAGCAAGGCAGGTTGGATGGGAGTGGGCACCTCAGAAAGTCACCAGGACTTGGGGTCAGGAACAGTGGCTGGGTGGGCCCAGAACTGCCCCCACTGTCCCCCTACCCACCGATGGAGCCCCCAGATAGAGCTGGGTGGCCTGTTTCTGCAGCCCTTGGGCAGTTCTCACTCCTAGGAGAGCCAACCTCGGCTTGTGGGCTGGTGCCCCACAGCTACCTGAGACGGGCATCGCAGGAGTCTCTGCCACCCACTCAGGATTGGGAATTGTCTTTAGTGCCGGCTGTGGAGCAAAAGGCAGCTCACCCCTGGGCAGGCGGTCCCCATCCCCACCAGCTCGTTTTTCAGCACCCCCACCCACCTCCACCCAGCCCCTGGCACCTCCTCTGGCAGACTCCCCCTCCTACCACGTCCTCCTGGCCTGCATTCCCACCCCCTCCTGCCAGCACACAGCCTGGGGTCCCTCCCTCAGGGGCTGTAAGGGAAGGCCCACCCCAACTCTTACCAGGAGCTGCTACAGGCAGAGCCCAGCACTGATAGGGCCCCGCCCACCGGGCCCCGCCCACCCCAGGCCACATCCCCACCCATCTGGAAGTGAAGGCCCAGGGACTCCTCCAACAGACAACGGACGGACGGATGCCGCTGGTGCTCAGGAAGAGCTAGTGCCTTAGGTGGGGGAAGGCAGGACTCACGACTGAGAGAGAGAGGAGGGGGATATGACCACCCTGCCCCATCTGCAGGAGCCTGAAGATCCAGCTCAAGTGCCATCCTGCCAGTGGCCCCCAGACTGTGGGGTTGGGACGCCTGGCCTCTGTGTCCTAGAAGGGACCCTCCTGTGGTCTTTGTCTTGATTTTTCTTAATAAACGGTGCTATCCCCGCCAGGGGCCTCCTGAGTCTTTGATGAGGGCTTCACTCAGTGGAGCCTGTGGATGGGGCAGAGCAGGGCAGGTGAGATCTGGGGGTGAAGCAAGCTGGCTTGGGATCAGCGAGGCCCCCAGGCCCCCAACCCTGTGAGGCAGGAATTGTCCTATTTTCTAGAGGGGCAGCTGAGTCTCAGAGGGTTAGGGGGCCTGTCCAACATCAGACAGAGAGCCAGGGGGTTAGAACCCAAAGAGTCTGACCCCAGAGCCTAGTATCATTCCCATGTGCCCGAAGCCCCTCTAGGGATGGCCTCCCTGATCCTATAAGGCTGGGCCACTCAACTGCAGCCCCCTGGGGAGACCTGGCTGGGACATGGGTAGCACGTGGTACAGGCTGTGCTGCAGTGGAGGCAGAGGCCACGGGCACCAGGTTGCCAGGCCAGCCAGCTGGGAGAGCAACAGCACCAGAGGAGGCCCAGGAGGAGGCCAGCAGAGGCCAGGAGCATCGAGGAGGCCAGCGCCACCCCTCAGAGCTGGGGGCCTGTGGGAAGAGAAAGTCCACTCAGGCCTCGGCCTGGGTCCTCTGCCCCGTCCCCATCACCTAGAGAGGGACAGGTATGATTTTGGTGGGAAGAGTAGGAGCAAGGTGTAACCTTCCAAAGCTGCGTCTTGTCTCGTGGGGTCCCTGCCTGCTGGGGAACTCCTCTCAGCTGCAATCCAGAGGGATCCTGCAGACCCGAGAGCTGGGGAGGGAGTCAGGGATCTGGAGGTATGGGCATCTGTACTTCCTGTCTGGCTGGGCACCGGAGAGGGACCTGCATGGGAAAGAACAGAACTAGCACACTGAGAACTGCCCTTTCTGGGACACTTGTGTGTTTCATTCAATCCTCACAAGACTTCCCTGAGTTTGTCACTCTGTGTTTCCATTTTACAGAGAGGTTGTCACTTGCCGAGTTCAATTAGCTGGAAGTGATAGGAGGACTTGAACTCACATGGTCTGGCTCCAGGGCCTAAGGTCTATGAGTGGAGCTACTTCCCAAGGAAGAGGGTGTACATGTACTGAGCATTGAGGCAGGGTCTCACTCTGTCG