Transcript asmbl_12327

Sequence
Transcript Sequence for observation asmbl_12327 of TGE0056751:
GTTTTGTGCTGAGGTCCCTATATGGTTGTGTTAGACTGAACGACAGGCTCAAGTCTGTCTTTGCTCCTTGTTTGGGAAGCAAGTGGGAGGAGAGCAGGCCAAGGGGCTATATAACCCTTCAGCTTTCAGCTTCCCTGAACACCACCCAGTGTGGAGCAGCCCAGCCAAGCACTGTCAGGAATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAG