Transcript asmbl_11344

Sequence
Transcript Sequence for observation asmbl_11344 of TGE0056983:
GGTGGAAGAAAAGTCAGGCAAACACAAGCACGCACACACCACTGGGAGATCAGATCTTCTAGCTGGCTCTCTGCTGCCACAGCTCCGCCGAAGGGAGGGGGTGGAAGAGGAGGACTAAACTCAGAGCTGAGAGGAGAGGCAGGTGTGTGCAGGTGCATCACCTGGATCATGAGGTCACCCCTCTGCTGGCTCCTCCCACTTCTCATCTTGGCCTCAGTGGCCCAAGGCCAGCCAACAAGACGACCAAGACCCGGGACTGGGCCCGGGCGCAGACCCAGGCCCAGGCCCAGGCCCACACCCAGCTTTCCTCAGCCTGATGAACCAGCAGAGCCAACAGACCTGCCTCCTCCCCTCCCTCCAGGCCCTCCATCTATCTTCCCTGACTGTCCCCGCGAATGCTACTGCCCCCCTGATTTCCCATCTGCCCTCTACTGTGATAGCCGCAACCTGCGAAAGGTCCCTGTCATCCCGCCCCGCATCCATTACCTCTATCTCCAGAACAACTTCATCACTGAGCTCCCGGTGGAGTCCTTCCAGAATGCCACAGGCCTGCGATGGATTAACCTGGACAACAACCGAATCCGCAAGATAGACCAGAGGGTGCTGGAGAAACTGCCCGGCCTGGTGTTCCTCTACATGGAGAAGAACCAGTTGGAAGAGGTCCCCTCGGCCCTGCCCCGGAACCTGGAGCAGCTGAGGCTGAGCCAGAACCACATCTCCAGAATCCCGCCTGGTGTCTTCAGCAAGCTGGAGAACCTGCTGCTCCTGGATCTCCAGCACAACAGGCTGAGCGACGGCGTCTTCAAGCCCGACACCTTCCATGGCCTCAAGAACCTCATGCAGCTCAACCTGGCCCACAACATCCTGAGAAAGATGCCGCCCAGGGTCCCCACCGCCATTCACCAGCTCTACCTGGACAGTAACAAGATTGAGACCATCCCTAACGGATACTTCAAGAGCTTTCCCAATCTTGCCTTCATTCGGCTTAACTACAACAAGCTGACAGACAGGGGACTCCCCAAGAACTCCTTTAATATCTCCAACCTGCTTGTGCTCCACCTGTCCCACAACAGGATCAGCAGTGTGCCCGCCATCAACAACAGGCTGGAACACCTGTACCTCAACAACAATAGCATCGAGAAAATCAACGGAACCCAGATTTGCCCCAACGACCTAGTGGCGTTCCATGACTTCTCCTCGGACCTGGAGAACGTGCCACACCTGCGCTACCTGCGGCTGGATGGAAACTACTTGAAGCCGCCCATCCCGCTGGACCTCATGATGTGCTTCCGCCTCCTGCAGTCCGTGGTCATCTAGGCCCTACTCCGCCACCGGATCTGCTCTGACCGCACTTGAAGGCTGGGGCCCAGGCACCTGTGCCGGCCATTCGTTTTCTCTCTCTCCCTTTCTTTCTCCCAGCTTTGCCTCCCTTATCCCACCCTCGAGGCAGGGAAAAGCCATCTATTCTTCTGCAGCCTCAGGAGCGAGACTTCAAGGACTCAGTTTGGTTCCACCCAGTTGAAAGACACCCAGTGCACACCCAAACTCCTGGCCTTCTGTGGTTTCCCTTTGCTCCAGAAACACAGATGTGTCTAAAGACTTGGTGTCCCCTTCTCTCTCCTCCCCCACCCGCCACTCCTGGGTACATCTGGGCCGTGGACTATCTGATCTTGGTCCTGGCCGAGCAAACAGCCCGGAGGTAAGGTTCAGAAAGTCCCCCTGGGGACTCCTCCATCTTCGGCAGCTCTGGCTCAAAGAGGCCGAGAAACCCAGTTCTCCTGGGCCAAGGATCCCTTCTGGCAAAGCTGCTGCTCCGCCGCTTGGTTCCCCGGCACCAGACATCGCCCTGGCCCTGCTGGCCCGGGTATCGGGAAGGAGGAGCGAGGGAATGACGGAGGTAGGGTGCAGGGTCAGGGCTCCCGCAGGGGCCTGCATCTGGCCAGCAGGACACAGGGATGCGCAGGGCGCCCCCTTCTGTTCCAGGGTGAACATAGCACACGCCCTCCTGGCTGGGCCTCAGGAGGAACAGCCAAGGAGAAGAATGGCCCAAGGAACTAGGAAGCAGCCATGGGAGAGGGGAAGGGTTCAAGCCCGGGATGGGCCCGCGTGACGTCGATGGGTCCTGCGGCCCCCTTGCCCAACCTCGGGTTTAGGGAGGAGGGTTCACAGTGTTTTTGTGGGGGCGGGGGAAGGAAGAGGCAGCCCCGCCCCCGCCATCTGTTCTCCATCAGTGTGCGCGGCCCAGCCATTTCCACCCTCGGGAGGCGGCTCCTGAGAAACAGGGAGGAAGGGGCGGAGCACCTGGACGTCTCCCAGAAGCCCCTCCACGTTTGAAAATGCGCCTCCTCCTCGGAGACAGACGCATCGGTGCCACCTAGTGGCTGGTGGGAGTAACAGCTGGTCCCAGTCTTGCGCCTGGCCCTCTTCCTGGGGTGATTTTCCTCGGTGGAGGAGGCCCGTGGGGTCCCAACACGGAAGAGCCATGGGCCGTGTGCATGGTGTCGCTCTCCTCTAGGGTCTAGCGGGCACAAACGTCCCCAGGCTGGGCTCATTCCCATCGTGAGTGAGCCCAGGTGAGGACATAGTCGGCTCCCGTTTGTTGTAGGCCCTTCCCAGGTGCCTTCTCAGCTCCCTCATCTGTAAACCGAGGAGGTGGATAAGATGCTCCCGGCCGGGCGCGGTGGCTCACGC