Transcript asmbl_112184

Sequence
Transcript Sequence for observation asmbl_112184 of TGE0056091:
CCTGCCTTGGCCTCCCAAAATTCTAGGATTACAGGTGTGAGCTACCACACTTGGCCAGGGATGTCTAATGTGGCTGCTACACCCCATGTAAAAAGCGGAAAATAAAATGAAGATTTTCCAGCGCAAGATGCGGTACTGGTTGCTTCCACCTTTTTTGGCAATTGTTTATTTCTGCACCATTGTCCAAGGTCAAGTGGCTCCACCCACAAGGTTAAGATATAATGTAATATCTCATGACAGTATACAGATTTCATGGAAGGCTCCAAGAGGGAAATTTGGTGGTTACAAACTTCTTGTGACTCCAACTTCAGGTGGAAAAACTAACCAGCTGAATCTGCAGAACACTGCAACTAAAGCAATTATTCAAGGCCTTATGCCAGACCAGAATTACACAGTTCAAATTATTGCATACAATAAAGATAAAGAAAGCAAGCCAGCTCAAGGCCAATTCAGAATTAAAGATTTAGAAAAAAGAAAGGATCCAAAGCCCAGAGTCAAAGTTGTGGACAGAGGAAATGGGAGTAGACCATCTTCACCAGAAGAAGTGAAATTTGTCTGTCAAACTCCAGCAATTGCTGACATTGTAATCCTGGTCGATGGTTCATGGAGTATTGGAAGATTCAACTTCAGACTGGTTCGGCATTTCTTGGAAAACCTGGTTACAGCATTCGATGTGGGCTCAGAGAAGACACGAATTGGTCTTGCACAGTATAGTGGTGACCCCAGAATAGAATGGCACTTGAATGCATTTAGCACAAAAGATGAAGTGATTGAAGCTGTCCGAAACCTCCCATATAAAGGAGGAAATACACTAACAGGTCTTGCTTTGAACTACATTTTTGAAAATAGCTTCAAACCAGAAGCAGGATCAAGGACTGGAGTATCCAAAATTGGCATTTTAATCACAGATGGAAAATCCCAAGATGACATTATTCCACCATCTAGAAATCTTCGTGAGTCTGGTGTAGAACTGTTTGCCATAGGGGTGAAAAACGCGGATGTGAATGAGCTGCAGGAGATCGCCTCTGAACCAGACAGCACTCATGTGTACAATGTTGCCGAATTCGATCTGATGCACACAGTTGTGGAGAGTCTGACCAGGACTCTCTGCTCTAGAGTGGAAGAACAGGACAGAGAAATTAAAGCCTCAGCCCATGCCATCACTGGGCCGCCTACGGAGTTGATTACTTCTGAAGTCACTGCCAGAAGCTTTATGGTTAACTGGACTCATGCCCCAGGAAATGTGGAAAAATACAGAGTTGTGTATTATCCTACCAGGGGTGGAAAACCAGACGAGGTGGTGGTAGATGGAACTGTATCTTCCACAGTGTTGAAAAACTTGATGTCTTTAACTGAATATCAGATAGCAGTCTTTGCAATCTATGCCCACACTGCTAGTGAAGGCCTACGGGGAACTGAAACTACACTTGCTTTACCGATGGCTTCTGACCTTCTACTGTACGACGTGACTGAGAACAGCATGCGAGTCAAATGGGATGCAGTGCCTGGGGCCTCAGGTTACCTGATCCTTTATGCTCCTCTAACAGAGGGCCTGGCTGGGGATGAAAAAGAGATGAAAATTGGAGAGACCCACACAGATATTGAATTGAGTGGGTTGTTGCCCAATACAGAATACACAGTCACAGTTTATGCCATGTTTGGAGAAGAGGCCAGTGATCCTGTTACGGGACAAGAAACAACATTGGCTTTAAGTCCACCAAGAAACCTGAGAATCTCCAATGTTGGCTCTAACAGTGCTCGATTAACCTGGGACCCAACTTCAAGACAGATCAATGGTTATCGAATTGTATATAACAATGCAGATGGGACTGAAATCAATGAGGTTGAAGTCGATCCTATTACTACCTTCCCTCTGAAGGGCTTGACACCTCTCACAGAGTATACTATTGCTATTTTCTCCATCTATGATGAAGGACAGTCAGAGCCTCTGACTGGAGTTTTTACCACCGAGGAAGTTCCAGCCCAGCAATACTTAGAAATTGATGAGGTGACGACAGACAGTTTTAGGGTGACCTGGCATCCCCTCTCAGCTGATGAAGGGCTACACAAATTGATGTGGATTCCAGTCTATGGGGGGAAGACTGAGGAGGTTGTCCTGAAAGAAGAGCAGGACTCACATGTTATTGAAGGCCTGGAGCCCGGTACGGAGTATGAAGTTTCACTATTGGCCGTACTTGATGATGGAAGCGAGAGTGAGGTGGTGACTGCTGTCGGGACCACACTTGACAGTTTTTGGACAGAACCAGCTACAACCATAGTGCCTACCACATCTGTGACTTCAGTTTTCCAGACGGGAATCAGAAACCTAGTTGTAGGTGATGAAACTACTTCTAGCCTGCGGGTAAAATGGGACATTTCTGACAGCGATGTGCAGCAGTTTAGGGTGACCTACATGACAGCTCAAGGGGACCCTGAGGAAGAAGTCATAGGAACGGTTATGGTGCCTGGAAGCCAGAACAACCTCCTTCTGAAGCCTCTGCTTCCTGATACTGAATACAAAGTCACAGTGACTCCCATCTACACGGATGGCGAAGGCGTCAGCGTCTCCGCTCCTGGAAAAACCTTACCATCCTCGGGGCCCCAGAACTTGCGGGTGTCCGAGGAATGGTATAACCGGTTGCGCATTACGTGGGACCCCCCATCTTCCCCGGTGAAAGGCTATAGAATTGTCTACAAACCTGTCAGTGTTCCTGGTCCAACACTGGAAACGTTTGTGGGAGCTGACATTAACACCATCCTTATCACAAACCTCCTCAGCGGAATGGACTACAATGTGAAGATATTTGCCTCCCAGGCCTCAGGCTTCAGCGACGCCCTGACAGGCATGGTGAAAACATTGTTCTTGGGTGTTACCAATCTCCAAGCCAAACATGTTGAAATGACCAGCTTGTGTGCCCACTGGCAGGTACATCGCCATGCCACAGCCTATAGGGTTGTTATAGAATCCCTCCAGGATAGGCAAAAGCAAGAATCCACTGTGGGTGGAGGGACAACCAGGCATTGCTTCTATGGACTTCAGCCTGATTCTGAATATAAAATCAGTGTTTATACAAAGCTCCAGGAGATTGAAGGACCTAGTGTGAGCATAATGGAAAAAACACAATCACTTCCTACACGACCACCAACTTTTCCTCCAACCATTCCACCAGCAAAAGAAGTATGTAAGGCGGCCAAGGCTGACCTGGTATTTATGGTGGATGGATCCTGGAGCATTGGAGATGAAAATTTCAATAAGATCATCAGCTTTCTATACAGCACTGTTGGAGCCCTGAACAAGATTGGCACAGATGGAACCCAAGTTGCAATGGTTCAGTTCACTGATGATCCCAGAACAGAATTTAAACTAAATGCTTACAAAACCAAAGAGACTCTTCTTGATGCAATTAAACACATTTCATACAAAGGAGGAAATACAAAAACAGGAAAAGCAATTAAGTATGTTCGAGATACCTTGTTCACTGCAGAGTCAGGTACAAGAAGGGGCATCCCAAAGGTTATCGTGGTTATAACTGATGGAAGATCACAAGATGATGTGAACAAAATCTCCAGGGAGATGCAATTAGATGGCTATAGCATTTTTGCAATTGGTGTGGCCGATGCAGATTACTCGGAGTTGGTTAGCATTGGCAGTAAGCCCAGCGCACGCCATGTCTTCTTTGTGGATGACTTTGACGCCTTTAAGAAAATCGAAGATGAGTTAATTACTTTTGTCTGCGAAACAGCATCAGCAACCTGTCCAGTGGTACACAAGGATGGCATTGATCTTGCAGGATTTAAGATGATGGAAATGTTTGGTTTGGTTGAAAAAGATTTTTCATCAGTGGAAGGGGTTTCTATGGAGCCTGGTACCTTCAATGTGTTTCCATGTTACCAACTCCATAAAGATGCCCTGGTTTCCCAGCCAACCAGGTACTTGCACCCAGAAGGATTGCCCTCCGACTACACAATCAGTTTTCTATTCCGGATTCTTCCTGACACTCCACAGGAGCCATTTGCTCTTTGGGAGATTTTAAATAAAAATTCTGACCCATTGGTTGGGGTTATTTTAGACAATGGTGGGAAAACTCTAACATATTTCAACTATGACCAGAGTGGGGATTTTCAAACTGTTACTTTCGAAGGACCTGAAATTAGGAAAATTTTTTATGGAAGCTTTCACAAGCTACACATTGTTGTCAGTGAGACTTTGGTCAAAGTGGTTATTGACTGCAAGCAAGTGGGTGAGAAGGCAATGAACGCATCAGCTAATATCACGTCAGATGGTGTAGAAGTGCTAGGGAAAATGGTTCGATCAAGAGGACCAGGTGGAAACTCTGCACCGTTCCAGTTACAGATGTTTGATATTGTTTGCTCCACATCATGGGCCAATACAGACAAATGCTGTGAACTTCCAGGCCTGAGAGATGATGAGTCTTGCCCAGACCTTCCCCATTCCTGCTCCTGTTCTGAAACCAATGAAGTGGCTCTGGGACCAGCGGGCCCACCAGGTGGTCCAGGACTCCGAGGACCAAAGGGCCAGCAAGGTGAACCGGGTCCAAAGGGACCAGATGGCCCTCGGGGTGAAATTGGTCTGCCAGGACCTCAGGGTCCACCTGGACCTCAAGGACCAAGTGGTCTGTCCATTCAAGGAATGCCCGGAATGCCAGGAGAAAAAGGAGAGAAAGGAGATACTGGCCTTCCAGGTCCACAGGGTATCCCAGGAGGCGTTGGTTCACCAGGACGTGATGGCTCACCAGGCCAGAGGGGCCTTCCGGGAAAGGATGGATCCTCGGGACCTCCAGGACCACCAGGGCCAATAGGCATTCCTGGCACCCCTGGAGTCCCAGGGATCACAGGAAGCATGGGACCGCAAGGCGCCCTGGGACCACCTGGTGTCCCTGGAGCAAAGGGGGAACGAGGAGAGCGGGGTGACCTGCAGTCTCAAGCCATGGTGAGATCAGTGGCGCGTCAAGTATGCGAACAGCTCATCCAGAGTCACATGGCCAGGTACACTGCCATCCTCAACCAGATTCCCAGCCACTCCTCATCCATCCGGACTGTCCAAGGGCCTCCTGGGGAGCCTGGGAGGCCAGGCTCACCTGGAGCCCCTGGTGAACAAGGACCCCCAGGCACACCAGGCTTCCCCGGAAATGCAGGCGTGCCAGGGACCCCAGGAGAACGAGGTCTAACTGGTATCAAAGGAGAAAAAGGAAATCCAGGCGTTGGAACCCAAGGTCCAAGAGGCCCCCCTGGACCAGCAGGACCTTCAGGGGAGAGTCGGCCTGGCAGCCCTGGGCCCCCTGGCTCTCCTGGACCAAGAGGCCCACCAGGTCATCTGGGGGTTCCTGGACCCCAAGGTCCTTCTGGCCAGCCTGGATATTGTGACCCCTCATCATGTTCTGCCTATGGTGTGAGAGATCTGATCCCCTACAATGATTACCAGCACTGAAGTGGAAATCCTCCACTCTGGTTCCATTGGCCCCAGACATTTAGCTGTGGATACAGAACTGTCCTGTCAACCACCACCACCACCAAGCCCCTGCCCCTAACAATGGACACTCTGCTTCCCTGCTTCTTCTGCATCCCTGCCTTCCCACTTTCAAACCTCTTGCCCACTCTGCTCCAAACATGATGGAGTGATAACATCGGAACTTAACCAAATCATATATGTCTATTTTAATAGACACTGACTGCTCCATGTCAGCCTGGATAGAGGTATATGATCGTGTGCCAAGAATTTATCCCAGACTCCCCTGTGTGACAGCTTCATAATAAAGTTACTTAACTGTGCCTCTTCCTCCTTCCTCTCCCCACACAGGATGGATGGGCATCTTTCTCCTTGACCACCCTACTCTCCCTTCCTCCCCTGATCACCTCCCCTCCCTGCTCTTCCCTGGTGATGGACTTCTAACATGAGATTTTTTAAAAAAATTTCTATTTCTTTTATAATTTTGCTGAGTTTTCAGGGTTTCTTCTGTAAATAAAACATAATATTTAAATGGTTGGTTATGATTCTAGTTTTCTAACAATTTCTGTAATGTATCTTTCCCTTCGTCTATTTACTAACTGTCTGAAACCTTATGGGGAAGGTACAAGGGGCGTGGTGGATTAAGACATCCACTGCTTTTTACCCAGCAGGATATCTCTGTGTCTCTAAGGACCCAGGTGAGGGGAGAATATCAATTTATGATTCCTGGGTGCAGCAAGTCCCCACCCCCACTTTTCCTCTTTAGCTCCCCATCCAGATCAGCCAGAGTTCACCCCTGTCCAAGATGAGCTGGAAGCCATGGAACTGTGGGGCCCTGGAGTCTGATAGCCTCAGGAGAAATTTGAAGACCAACTGCAAGAACTCTTAAGGAATCTTGTTTGAGAAAATGTTGTTATGTGGTTTGTATGCTACTTTTGGGGGGCAGGGCTCATTTCAGCAGCCTAAATCTCCTCCTTGGATAATGTTAATATTATTATTATTATTAACAAAAAATATATATTTTTAAAAAGTTCCCTTAATCTATGACATGGTAGCAATGATTTCCCTTTGGTGTCTTAATGGCATGTCAGATAATTTGTTTTTCCAGAGAAGAGAGCTCAAAGAGGAATTGGGAAAAATAAATTGAACTCTGGAATCTTCTCTCTCAAGTCCTAAAATGAACAAACAGATATGATTGTGTTTGAGGGAAATATGTCCCTAGCAGGAAAAGAATTCAAAGAGGTTCAAAGAATATGTCACTTACTCCTACTTGCTGTAGGAATAACCTTGCTGATAAGAAAAAAAGGGACAATATTGGAGAAACTACCTCTTGTTTAATTGATCTGTCCAACTCTGAGATCACTTGGTAACTGGTTTCATGTGTATCCAAAAATCAGCATTTGGATTTAAGCTTTCTGAATTTGGTAGTTTAAGAAACAGATTTAGTTTTTCAGTGGTTTTAACTCATGTGAAATAATGATTTTCCACCAGCTCTGATGCAAAGAGATATAATTTTAATGAACGATTTATCCAGCAGTGTGTTCCAGGGGTTGCCTCTCCTTATCTACGGGGATTACTTTGTACATGCAGATAAGTTTTCGCAAACCTATTTCCATTTTCTTTTGTAAGCAAATAAAACTTTAAAACAATGTATGTGGATTCTTTTTCCTGCATTTCTAAGTATCACCTTAAGCTTTTGTAGTCTTAACTGAGTGTCCACCAGAAAGACAACAGTTGTCTTCCTTTAGGTAAGCATTCAAACTTTCATTCATTCGTTTACTCACTCACTCATTCATTCATTCTGAGTGCAGTAGAAAACAGAAGAAGCAGTTAACTTGGGACTAAGAGATTAGCGACATTTTATTGTTCATTTATAATCTAGCAGGCAGCAAAGACCCTGCAAATGCATGACCTCTGCTAAATAAATGTTTATCAATAGTTGACTGAGGAGCCCACCTATCTTCTGATATTGAGGAAAGCCTAAAAACCCCTAGAAGGCAGAGCAGAAATGAGGTTGAATCTAATAGACTCTAACCCTTAAACCATACTTTGTCTTTTGCTCACAAAGGAAAAATCTAGGTATTTGAGAAAGATTTGAATTCTATTATGTGCTAGTTGAAATAGAAACAAAAGAGAACCATAAATTTAATACGTGCTCCTTCTCTGTAACATCTCCCTAGTAACAGCTAACTTTAGAAAGTAGGGATGGGATCATTTACAACTAGAAGCTGGATTCTTTCTGGATCAGGAAAAGGCTAACACGAAGGATGGTGTCTGTCTGATCACCAGGTTCTCTTTCTGTCCTTCTCATAATCTCCTGATCTTTGGAGATGAAAGATCTCCTTTCATCTTCATCTGAAGGATTCTTCAGATGATTCATCTTCAGACTTCATCTGAAGGATTCAAACAATCTACTTGTGTGCCTTTGGTGGGGTGGGGCAGGGGCGGGGGGCGGTTCTAAACAAATCAGTTTTTTTGGTGTCTTTGCAGGGAATGAAAGAAGATAATGAGCAGATAATCAGCAGCCATTTCCTTTCAGTTATGGTATATGATTCTGCCTGAGAAAGCAGGATTTATGGGAAGGAAAACTTGTCTAAGGCTCATCAAGATGGCCTGACCCAGAGTCACCTAAGAGAACTCTTCCAACTTAAATGACTAGGGTGTGTAATCAGTTGCTTCTTATTCTGTGTCTCAGATTTCCTAGTCCATGACATTTAATAGTGAGTATAGAGTAGGATATTCTATACATTTTAGTATTTGGCCCTTGGAAACAAAGTTAAATACCATGTCACTCAGAAGACTCTCAAAGTTTGTGTATAAATGGCGAAGTATACACTATGAGAGATTCTAATCCATTCACATCATTCTTGAGTTGTGCAAATACACTTGGCTTTGATTTCACTTGGTGATCTAAATTTGTTTATTTAAGCTGCAAGAAAGTTACATTAATTTGGAATGTGTCATCACTTGGACCCAGTATATCAGATTTTTATTGAGTAAAATGTTAAAAATAATAAGTGTAACTCAGATTCTGGATGTTCGAGTTTACAATACATTGCCTGTAATAAAAGCTGATTCTGAAGTGCATTTTTCTTGACTTACTTTGGCAGAAATATACTTATATCTTAATTTATAGTTTGTAAGTTTATACTGTTTTCTAAAAGTAATAAATCATTTCA