Transcript asmbl_10715

Sequence
Transcript Sequence for observation asmbl_10715 of TGE0000010:
ATTTCCGCTTCCGCCTCCTTCTTTCTCGACAAGATGGCCACACCGGCGGTACCAGTAAGTGCTCCTCCGGCCACGCCAACCCCAGTCCCGGCGGCGGCCCCAGCCTCAGTTCCAGCGCCAACGCCAGCACCGGCTGCGGCTCCGGTTCCCGCTGCGGCTCCAGCCTCATCCTCAGACCCTGCGGCAGCAGCGGCTGCAACTGCGGCTCCTGGCCAGACCCCGGCCTCAGCGCAAGCTCCAGCGCAGACCCCAGCGCCCGCTCTGCCTGGTCCTGCTCTTCCAGGGCCCTTCCCCGGCGGCCGCGTGGTCAGGCTGCACCCAGTCATTTTGGCCTCCATTGTGGACAGCTACGAGAGACGCAACGAGGGTGCTGCCCGAGTTATCGGGACCCTGTTGGGAACTGTCGACAAACACTCAGTGGAGGTCACCAATTGCTTTTCAGTGCCGCACAATGAGTCAGAAGATGAAGTGGCTGTTGACATGGAATTTGCTAAGAATATGTATGAACTGCATAAAAAAGTTTCTCCAAATGAGCTCATCCTGGGCTGGTACGCTACGGGCCATGACATCACAGAGCACTCTGTGCTGATCCACGAGTACTACAGCCGAGAGGCCCCCAACCCCATCCACCTCACTGTGGACACAAGTCTCCAGAACGGCCGCATGAGCATCAAAGCCTACGTCAGCACTTTAATGGGAGTCCCTGGGAGGACCATGGGAGTGATGTTCACGCCTCTGACAGTGAAATACGCGTACTACGACACTGAACGCATCGGAGTTGACCTGATCATGAAGACCTGCTTTAGCCCCAACAGAGTGATTGGACTCTCAAGTGACTTGCAGCAAGTAGGAGGGGCATCAGCTCGCATCCAGGATGCCCTGAGTACAGTGTTGCAATATGCAGAGGATGTACTGTCTGGAAAGGTGTCAGCTGACAATACTGTGGGCCGCTTCCTGATGAGCCTGGTTAACCAAGTACCGAAAATAGTTCCCGATGACTTTGAGACCATGCTCAACAGCAACATCAATGACCTTTTGATGGTGACCTACCTGGCCAACCTCACACAGTCACAGATTGCACTCAATGAAAAACTTGTAAACCTGTGAATGGACCCCAAGCAGTACACTTGCTGGTCTAGGTATTAACCCCAGGACTCAGAAGTGAAGGAGAAATGGGTTTTTTGTGGTCTTGAGTCACACTGAGATAGTCAGTTGTGTGTGACTCTAATAAACGGAGCCTACCTTTTGTAAATTAATTTCATCTTATGTGAGTTTATTGCCGGGTGGAAGGGAGGAAAATGTTTTAGATCACACAGAAACTAGGAAGTGAATATTGTAGGTAGAGAAGTTGGTTATGTGTTTGGCATGTTACTGTTTTACCAAACTGTTCTTTTGGTTTTCAATATGGA